
DNA-Free HS Taq-D DNA Polymerase
All products have special prices for bulk purchase, please contact for more details if required.
Cat. No.: DFHDUT-500 (for 500U)
Cat. No.: DFHDUT-2500 (for 500U×5)
Cat. No.: DFHDUT-10KU (for 2500U×4)
Cat. No.: DFHDUT-25KU (for 2500U×10)
Description
DNA-Free HS Taq-D DNA Polymerase is the hot-start version of Taq-D DNA Polymerase (KlenTaq), requiring activation by heating at 95°C for 5 minutes or at 98°C for 2 minutes. It is a recombinant, genetically engineered Taq DNA polymerase derived from the thermophilic bacterium Thermus aquaticus, with the 5' exonuclease domain deleted. The enzyme exhibits 5'→3' polymerase activity, no 5'→3' exonuclease activity, and no 3'→5' exonuclease activity. Amplification products have 3'-dA overhangs. It can amplify fragment lengths up to 3 kb with an extension rate of 1.0 kb/min (72°C). This enzyme is not suitable for TaqMan probe-based q-PCR. It is especially suitable for single nucleotide polymorphism (SNP) typing by melting curve analysis and for amplifying samples containing PCR inhibitors, such as blood.
Our DNA-Free HS Taq-D DNA Polymerase, on the other hand, is devoid of genomic and plasmid DNA from the production strain. This makes Taq-D DNA Polymerase particularly suitable for amplifying, sequencing, and cloning 16S and 23S rDNA genes, as well as for standard applications like PCR and primer extension.
Activity Definition
The enzyme activity is defined as the amount of enzyme required to incorporate 10 nmol of deoxyribonucleotides into acid-insoluble material at 72°C for 30 minutes, using Mahi Mahi sperm DNA as a template/primer, and is expressed as one unit (U).
Features
Hot-start polymerase, enhancing amplification specificity and reducing non-specific amplification and primer-dimer formation.
More suitable for PCR of untreated blood, tissue, saliva samples compared to ordinary Taq DNA Polymerase.
Excellent thermal stability: Half-life exceeds 40 minutes at 95°C.
Broad tolerance range for template DNA.
PCR products have 3'-dA overhangs, suitable for direct T/A cloning.
Can incorporate dUTP, dITP, and fluorescently labeled nucleotides.
Applications
Single nucleotide polymorphism (SNP) typing by melting curve analysis.
Direct PCR of blood, tissue samples, etc.
DNA fluorescence labeling.
Storage
Note: All product outward appearance, the size color take the material object as. The picture only supplies the reference.
SBS Genetech is recognized as one of the global major leading industry players in DNA Polymerase by third-party market researchers. For more details, please visit DNA Polymerase Market Size To Reach USD 568.3 Million In 2030 | Rising Demand For Customized DNA Polymerase And Next-Generation DNA Sequencing Are Some Of The Key Factors Driving Market Revenue Growth, Says Reports and Data
Featured Citations
Interested in seeing published research using our U-Taq DNA Polymerase?
Pseudomonas spp. associated with tomato pith necrosis in the Salto area, Northwest Uruguay
European Journal of Plant Pathology | 19 Jan 2023 | DOI: https://doi.org/10.1007/s10658-023-02639-6
The PCR reactions contained 1X PCR buffer, 2.5 mM MgCl2, 0.4 mM of each dNTP, 0.4 μM of each primer, 1 U Taq polymerase (SBS Genetech Co., Ltd., China), and 1 μL of template DNA (100 ng μl−1). The PCR reaction was adjusted to a final volume of 25 μl with MQ water.
Sequencing of Norovirus in Southern, Nigeria: Prevalent Genotypes and Putative GII.4 Novel Recombinants among Children
Genetic Variation | 16 Dec 2020 | DOI: https://doi.org/10.5772/intechopen.94389
The RT-PCR used is a very sensitive method, it can detect as few as 5 x 106 copies per gram of stool sample. U-TaQ DNA polymerase (SBS genetech, Beijing, China), a high-fidelity thermostable enzyme that can withstand prolonged incubation at high temperature up to 95°C without significant loss of activity was used for this RT-PCR protocol.
Semi-nested polymerase chain reaction over blood culture in detection of bloodstream fungal infection in leukemic children with febrile neutropenia
Journal of Applied Hematology | 17 Nov 2020 | DOI: https://doi.org/10.4103/joah.joah_41_20
Taq polymerase enzymes and customized primers were procured from SBS Genetech Co., Ltd., China.
Expression, purification and initial characterization of human serum albumin domain I and its cysteine 34
PLOS ONE | 12 Oct 2020 | DOI: https://doi.org/10.1007/s10658-023-02639-6
Total RNA from HepG2 cells was isolated using the RNeasy mini kit (QIAGEN) following manufacturer’s instructions. Retrotranscription was performed using 2.5 μg of RNA, a specific HSA oligonucleotide (ATAAGCCTAAGGCAGCTTGACTGG) and Superscript II reverse transcriptase (Invitrogen). The full-coding sequence of HSA was PCR- amplified with U-Taq (SBS GeneTech)
Evaluation of Nested broad-range PCR for Pathogen Detection in Negative Blood Cultures
JOURNAL OF CLINICAL RESEARCH AND APPLIED MEDICINE | 6 Oct 2020 | DOI: https://doi.org/10.5530/jcram.2.2.11
Taq polymerase enzymes and customized primers were procured from SBS Genetech Co., Ltd., China.
Identificación por catálogo y detección molecular de bovinos Holstein portadores de braquiespina en Uruguay
Revista FAVE. Sección Ciencias veterinarias | 1 Aug 2020 | DOI: https://doi.org/10.14409/favecv.v19i2.9523
La reacción fue puesta a punto en un volumen final de 25µL conteniendo: 100ng de ADN genómico, 2.5µL de Buffer de PCR 10X (Mg2+: 20mM), 1µM de cada primer, 10mM dNTPs y 0.4µL U-Taq ADN polimerasa (SBS Genetech Co., Ltd., China).
Only for research and not intended for treatment of humans or animals

Journals Using SBS Genetech Products Universities Using SBS Genetech Products

SBS Genetech is a long-term sponsor of Cold Spring Harbor Laboratory

